Review



cell lines jurkat cells atcc cat  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    ATCC cell lines jurkat cells atcc cat
    Cell Lines Jurkat Cells Atcc Cat, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 4461 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+jurkat+e6+1+atcc+cat/Jurkat%2C+Clone+E6-1/pm41265436-276-177-181
    Average 99 stars, based on 4461 article reviews
    cell lines jurkat cells atcc cat - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Protein Purification:

    Article Title: Immunosequencing identifies signatures of T cell responses for early detection of nasopharyngeal carcinoma.
    Article Snippet: B3) BioLegend Cat#502512; RRID: AB_315236 Biological samples Serum samples from healthy individuals This paper N/A PBMC samples from NPC patients This paper N/A Tumor samples from NPC patients This paper N/A Chemicals, peptides, and recombinant proteins Human IL-2 Peprotech Cat#AF-200-02-500UG DMEM medium Gibco Cat#C11995500BT Penicillin-streptomycin Gibco Cat#15140-122 RPMI 1640 medium Hyclone Cat#SH30809.01 HEPES Gibco Cat#15630130 Sodium pyruvate Gibco Cat#11360070 Non-essential amino acids Gibco Cat#11140050 β-mercaptoethanol Sigma-Aldrich Cat#M6250 TransIT-293 Mirus Bio Cat#MIR2700 Polybrene Sigma-Aldrich Cat#TR-1003-G Liposome YEASEN Cat#40802ES03 Human serum Gemini Cat#100-512 PBS Gibco Cat#C20012500BT 7-AAD viability staining solution BioLegend Cat#420404 Permeabilization buffer Invitrogen Cat#00-8333-56 List of peptides GenScript Table S4 Critical commercial assays ELISA kit for EBV VCA-IgA Euroimmun Cat#EI 2791-9601 A DNeasy Blood Extraction kit Qiagen Cat#69506 AllPrep DNA/RNA Mini Kit Qiagen Cat#80204 QIAGEN Multiplex PCR Plus Kit QIAGEN Cat#206152 Phusion HotStart DNA polymerase kit Phusion Cat#4464269 Agencourt® Ampure® XP beads Beckman Coulter Cat#63881 Qubit dsDNA HS Assay Kit Invitrogen Cat#Q32854 NEBNext Ultra mRNA Library Prep Kit NEB Cat# E7530 Qubit dsDNA HS Assay Kit Invitrogen Cat#Q32851 KAPA Library Quant Kit universal qPCR Mix Illumina KK4824 NovaSeq S4 reagent Kit Illumina Cat#20028312 PrimeSTAR Takara Cat#R045B Nucleic acid extraction kit CWBIO Cat#CMY017S (Continued on next page) ll OPEN ACCESS Article e1 Cancer Cell 43, 1–19.e1–e10, August 11, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Protein purification kit NucleoSpin Cat#740609.250 Illumina Infinium Asian Screening Array-24 (v1.0) Illumina Cat#20016319 Deposited data Human tumor scRNA-seq data Bei et al.31 GSE162025 Human tumor scRNA-seq data Guan et al.37 GSE150825 Bulk RNA-seq data Zhang et al.38 GSE102349 Bulk TCR-seq data This paper OMIX database: PRJCA027151 VDJdb database (20191113) https://vdjdb.cdr3.net/ https://vdjdb.cdr3.net/ Experimental models: Cell lines Jurkat E6.1 ATCC CatTIB-152 HEK-293T ATCC Cat#CRL-3216 K562 ATCC Cat#CCL-243 HepG2 ATCC Cat#HB-8065 PBMCs for retroviral transduction Sailybio Cat#SLB-HP050B COS-7 Laboratory of Zeng YX. and Xu M. N/A HK1 Laboratory of Zeng YX. and Xu M. N/A C666 Laboratory of Zeng YX. and Xu M. N/A TCR-F5-Jurkat This paper N/A TCR-ID1-Jurkat This paper N/A SCT-K562 This paper N/A TCR-expressing primary T cells This paper N/A EBV ORF-transduced APCs This paper N/A Oligonucleotides Oligonucleotide pool encoding the EBV epitopes Twist Bioscience PCR primers for SCT cDNA library: 5′-GGACCCTCCGCATCC-3′and 5′-GGACCCTCCGCATCC-3′ This paper N/A PCR primer for SCT-Forward: 5′-AATGATACGGCGA CCACCGAGATCTACACTCTT TCCCTACACGACGCTCTTCC GATCTGGCCTGCTTTGTTTG CC-3′ This paper N/A PCR primer for SCT-Reverse, 5′GTGACTGGAGTTCAGACGT GTGCTCTTCCGATCTCCTCCA CCACCGCTACCTC-3′ This paper N/A Recombinant DNA Plasmid:pCCLc-peptide-β2M-HLA-eGFP This paper N/A Plasmid:pCCLc-β2M-HLA-eGFP Dr. David Baltimore from California Institute of Technology N/A Plasmid:pLV-luciferase-puromycin Addgene plasmid # 117734 Plasmid:p3XFLAG-CMV-7-EBV gene ORFs (86 ORFs) Shair et al.36 N/A Plasmid:MSGV-LNGFR-P2ATCRα-F2A-TCRβ This paper N/A Plasmid:MSGV-CD8 Dr. David Baltimore from California Institute of Technology N/A Plasmid:pRD114 Addgene plasmid # 17576 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 43, 1–19.e1–e10, August 11, 2025 e2 ..

    RNA Sequencing:

    Article Title: Immunosequencing identifies signatures of T cell responses for early detection of nasopharyngeal carcinoma.
    Article Snippet: B3) BioLegend Cat#502512; RRID: AB_315236 Biological samples Serum samples from healthy individuals This paper N/A PBMC samples from NPC patients This paper N/A Tumor samples from NPC patients This paper N/A Chemicals, peptides, and recombinant proteins Human IL-2 Peprotech Cat#AF-200-02-500UG DMEM medium Gibco Cat#C11995500BT Penicillin-streptomycin Gibco Cat#15140-122 RPMI 1640 medium Hyclone Cat#SH30809.01 HEPES Gibco Cat#15630130 Sodium pyruvate Gibco Cat#11360070 Non-essential amino acids Gibco Cat#11140050 β-mercaptoethanol Sigma-Aldrich Cat#M6250 TransIT-293 Mirus Bio Cat#MIR2700 Polybrene Sigma-Aldrich Cat#TR-1003-G Liposome YEASEN Cat#40802ES03 Human serum Gemini Cat#100-512 PBS Gibco Cat#C20012500BT 7-AAD viability staining solution BioLegend Cat#420404 Permeabilization buffer Invitrogen Cat#00-8333-56 List of peptides GenScript Table S4 Critical commercial assays ELISA kit for EBV VCA-IgA Euroimmun Cat#EI 2791-9601 A DNeasy Blood Extraction kit Qiagen Cat#69506 AllPrep DNA/RNA Mini Kit Qiagen Cat#80204 QIAGEN Multiplex PCR Plus Kit QIAGEN Cat#206152 Phusion HotStart DNA polymerase kit Phusion Cat#4464269 Agencourt® Ampure® XP beads Beckman Coulter Cat#63881 Qubit dsDNA HS Assay Kit Invitrogen Cat#Q32854 NEBNext Ultra mRNA Library Prep Kit NEB Cat# E7530 Qubit dsDNA HS Assay Kit Invitrogen Cat#Q32851 KAPA Library Quant Kit universal qPCR Mix Illumina KK4824 NovaSeq S4 reagent Kit Illumina Cat#20028312 PrimeSTAR Takara Cat#R045B Nucleic acid extraction kit CWBIO Cat#CMY017S (Continued on next page) ll OPEN ACCESS Article e1 Cancer Cell 43, 1–19.e1–e10, August 11, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Protein purification kit NucleoSpin Cat#740609.250 Illumina Infinium Asian Screening Array-24 (v1.0) Illumina Cat#20016319 Deposited data Human tumor scRNA-seq data Bei et al.31 GSE162025 Human tumor scRNA-seq data Guan et al.37 GSE150825 Bulk RNA-seq data Zhang et al.38 GSE102349 Bulk TCR-seq data This paper OMIX database: PRJCA027151 VDJdb database (20191113) https://vdjdb.cdr3.net/ https://vdjdb.cdr3.net/ Experimental models: Cell lines Jurkat E6.1 ATCC CatTIB-152 HEK-293T ATCC Cat#CRL-3216 K562 ATCC Cat#CCL-243 HepG2 ATCC Cat#HB-8065 PBMCs for retroviral transduction Sailybio Cat#SLB-HP050B COS-7 Laboratory of Zeng YX. and Xu M. N/A HK1 Laboratory of Zeng YX. and Xu M. N/A C666 Laboratory of Zeng YX. and Xu M. N/A TCR-F5-Jurkat This paper N/A TCR-ID1-Jurkat This paper N/A SCT-K562 This paper N/A TCR-expressing primary T cells This paper N/A EBV ORF-transduced APCs This paper N/A Oligonucleotides Oligonucleotide pool encoding the EBV epitopes Twist Bioscience PCR primers for SCT cDNA library: 5′-GGACCCTCCGCATCC-3′and 5′-GGACCCTCCGCATCC-3′ This paper N/A PCR primer for SCT-Forward: 5′-AATGATACGGCGA CCACCGAGATCTACACTCTT TCCCTACACGACGCTCTTCC GATCTGGCCTGCTTTGTTTG CC-3′ This paper N/A PCR primer for SCT-Reverse, 5′GTGACTGGAGTTCAGACGT GTGCTCTTCCGATCTCCTCCA CCACCGCTACCTC-3′ This paper N/A Recombinant DNA Plasmid:pCCLc-peptide-β2M-HLA-eGFP This paper N/A Plasmid:pCCLc-β2M-HLA-eGFP Dr. David Baltimore from California Institute of Technology N/A Plasmid:pLV-luciferase-puromycin Addgene plasmid # 117734 Plasmid:p3XFLAG-CMV-7-EBV gene ORFs (86 ORFs) Shair et al.36 N/A Plasmid:MSGV-LNGFR-P2ATCRα-F2A-TCRβ This paper N/A Plasmid:MSGV-CD8 Dr. David Baltimore from California Institute of Technology N/A Plasmid:pRD114 Addgene plasmid # 17576 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 43, 1–19.e1–e10, August 11, 2025 e2 ..

    Retroviral:

    Article Title: Immunosequencing identifies signatures of T cell responses for early detection of nasopharyngeal carcinoma.
    Article Snippet: B3) BioLegend Cat#502512; RRID: AB_315236 Biological samples Serum samples from healthy individuals This paper N/A PBMC samples from NPC patients This paper N/A Tumor samples from NPC patients This paper N/A Chemicals, peptides, and recombinant proteins Human IL-2 Peprotech Cat#AF-200-02-500UG DMEM medium Gibco Cat#C11995500BT Penicillin-streptomycin Gibco Cat#15140-122 RPMI 1640 medium Hyclone Cat#SH30809.01 HEPES Gibco Cat#15630130 Sodium pyruvate Gibco Cat#11360070 Non-essential amino acids Gibco Cat#11140050 β-mercaptoethanol Sigma-Aldrich Cat#M6250 TransIT-293 Mirus Bio Cat#MIR2700 Polybrene Sigma-Aldrich Cat#TR-1003-G Liposome YEASEN Cat#40802ES03 Human serum Gemini Cat#100-512 PBS Gibco Cat#C20012500BT 7-AAD viability staining solution BioLegend Cat#420404 Permeabilization buffer Invitrogen Cat#00-8333-56 List of peptides GenScript Table S4 Critical commercial assays ELISA kit for EBV VCA-IgA Euroimmun Cat#EI 2791-9601 A DNeasy Blood Extraction kit Qiagen Cat#69506 AllPrep DNA/RNA Mini Kit Qiagen Cat#80204 QIAGEN Multiplex PCR Plus Kit QIAGEN Cat#206152 Phusion HotStart DNA polymerase kit Phusion Cat#4464269 Agencourt® Ampure® XP beads Beckman Coulter Cat#63881 Qubit dsDNA HS Assay Kit Invitrogen Cat#Q32854 NEBNext Ultra mRNA Library Prep Kit NEB Cat# E7530 Qubit dsDNA HS Assay Kit Invitrogen Cat#Q32851 KAPA Library Quant Kit universal qPCR Mix Illumina KK4824 NovaSeq S4 reagent Kit Illumina Cat#20028312 PrimeSTAR Takara Cat#R045B Nucleic acid extraction kit CWBIO Cat#CMY017S (Continued on next page) ll OPEN ACCESS Article e1 Cancer Cell 43, 1–19.e1–e10, August 11, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Protein purification kit NucleoSpin Cat#740609.250 Illumina Infinium Asian Screening Array-24 (v1.0) Illumina Cat#20016319 Deposited data Human tumor scRNA-seq data Bei et al.31 GSE162025 Human tumor scRNA-seq data Guan et al.37 GSE150825 Bulk RNA-seq data Zhang et al.38 GSE102349 Bulk TCR-seq data This paper OMIX database: PRJCA027151 VDJdb database (20191113) https://vdjdb.cdr3.net/ https://vdjdb.cdr3.net/ Experimental models: Cell lines Jurkat E6.1 ATCC CatTIB-152 HEK-293T ATCC Cat#CRL-3216 K562 ATCC Cat#CCL-243 HepG2 ATCC Cat#HB-8065 PBMCs for retroviral transduction Sailybio Cat#SLB-HP050B COS-7 Laboratory of Zeng YX. and Xu M. N/A HK1 Laboratory of Zeng YX. and Xu M. N/A C666 Laboratory of Zeng YX. and Xu M. N/A TCR-F5-Jurkat This paper N/A TCR-ID1-Jurkat This paper N/A SCT-K562 This paper N/A TCR-expressing primary T cells This paper N/A EBV ORF-transduced APCs This paper N/A Oligonucleotides Oligonucleotide pool encoding the EBV epitopes Twist Bioscience PCR primers for SCT cDNA library: 5′-GGACCCTCCGCATCC-3′and 5′-GGACCCTCCGCATCC-3′ This paper N/A PCR primer for SCT-Forward: 5′-AATGATACGGCGA CCACCGAGATCTACACTCTT TCCCTACACGACGCTCTTCC GATCTGGCCTGCTTTGTTTG CC-3′ This paper N/A PCR primer for SCT-Reverse, 5′GTGACTGGAGTTCAGACGT GTGCTCTTCCGATCTCCTCCA CCACCGCTACCTC-3′ This paper N/A Recombinant DNA Plasmid:pCCLc-peptide-β2M-HLA-eGFP This paper N/A Plasmid:pCCLc-β2M-HLA-eGFP Dr. David Baltimore from California Institute of Technology N/A Plasmid:pLV-luciferase-puromycin Addgene plasmid # 117734 Plasmid:p3XFLAG-CMV-7-EBV gene ORFs (86 ORFs) Shair et al.36 N/A Plasmid:MSGV-LNGFR-P2ATCRα-F2A-TCRβ This paper N/A Plasmid:MSGV-CD8 Dr. David Baltimore from California Institute of Technology N/A Plasmid:pRD114 Addgene plasmid # 17576 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 43, 1–19.e1–e10, August 11, 2025 e2 ..

    Transduction:

    Article Title: Immunosequencing identifies signatures of T cell responses for early detection of nasopharyngeal carcinoma.
    Article Snippet: B3) BioLegend Cat#502512; RRID: AB_315236 Biological samples Serum samples from healthy individuals This paper N/A PBMC samples from NPC patients This paper N/A Tumor samples from NPC patients This paper N/A Chemicals, peptides, and recombinant proteins Human IL-2 Peprotech Cat#AF-200-02-500UG DMEM medium Gibco Cat#C11995500BT Penicillin-streptomycin Gibco Cat#15140-122 RPMI 1640 medium Hyclone Cat#SH30809.01 HEPES Gibco Cat#15630130 Sodium pyruvate Gibco Cat#11360070 Non-essential amino acids Gibco Cat#11140050 β-mercaptoethanol Sigma-Aldrich Cat#M6250 TransIT-293 Mirus Bio Cat#MIR2700 Polybrene Sigma-Aldrich Cat#TR-1003-G Liposome YEASEN Cat#40802ES03 Human serum Gemini Cat#100-512 PBS Gibco Cat#C20012500BT 7-AAD viability staining solution BioLegend Cat#420404 Permeabilization buffer Invitrogen Cat#00-8333-56 List of peptides GenScript Table S4 Critical commercial assays ELISA kit for EBV VCA-IgA Euroimmun Cat#EI 2791-9601 A DNeasy Blood Extraction kit Qiagen Cat#69506 AllPrep DNA/RNA Mini Kit Qiagen Cat#80204 QIAGEN Multiplex PCR Plus Kit QIAGEN Cat#206152 Phusion HotStart DNA polymerase kit Phusion Cat#4464269 Agencourt® Ampure® XP beads Beckman Coulter Cat#63881 Qubit dsDNA HS Assay Kit Invitrogen Cat#Q32854 NEBNext Ultra mRNA Library Prep Kit NEB Cat# E7530 Qubit dsDNA HS Assay Kit Invitrogen Cat#Q32851 KAPA Library Quant Kit universal qPCR Mix Illumina KK4824 NovaSeq S4 reagent Kit Illumina Cat#20028312 PrimeSTAR Takara Cat#R045B Nucleic acid extraction kit CWBIO Cat#CMY017S (Continued on next page) ll OPEN ACCESS Article e1 Cancer Cell 43, 1–19.e1–e10, August 11, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Protein purification kit NucleoSpin Cat#740609.250 Illumina Infinium Asian Screening Array-24 (v1.0) Illumina Cat#20016319 Deposited data Human tumor scRNA-seq data Bei et al.31 GSE162025 Human tumor scRNA-seq data Guan et al.37 GSE150825 Bulk RNA-seq data Zhang et al.38 GSE102349 Bulk TCR-seq data This paper OMIX database: PRJCA027151 VDJdb database (20191113) https://vdjdb.cdr3.net/ https://vdjdb.cdr3.net/ Experimental models: Cell lines Jurkat E6.1 ATCC CatTIB-152 HEK-293T ATCC Cat#CRL-3216 K562 ATCC Cat#CCL-243 HepG2 ATCC Cat#HB-8065 PBMCs for retroviral transduction Sailybio Cat#SLB-HP050B COS-7 Laboratory of Zeng YX. and Xu M. N/A HK1 Laboratory of Zeng YX. and Xu M. N/A C666 Laboratory of Zeng YX. and Xu M. N/A TCR-F5-Jurkat This paper N/A TCR-ID1-Jurkat This paper N/A SCT-K562 This paper N/A TCR-expressing primary T cells This paper N/A EBV ORF-transduced APCs This paper N/A Oligonucleotides Oligonucleotide pool encoding the EBV epitopes Twist Bioscience PCR primers for SCT cDNA library: 5′-GGACCCTCCGCATCC-3′and 5′-GGACCCTCCGCATCC-3′ This paper N/A PCR primer for SCT-Forward: 5′-AATGATACGGCGA CCACCGAGATCTACACTCTT TCCCTACACGACGCTCTTCC GATCTGGCCTGCTTTGTTTG CC-3′ This paper N/A PCR primer for SCT-Reverse, 5′GTGACTGGAGTTCAGACGT GTGCTCTTCCGATCTCCTCCA CCACCGCTACCTC-3′ This paper N/A Recombinant DNA Plasmid:pCCLc-peptide-β2M-HLA-eGFP This paper N/A Plasmid:pCCLc-β2M-HLA-eGFP Dr. David Baltimore from California Institute of Technology N/A Plasmid:pLV-luciferase-puromycin Addgene plasmid # 117734 Plasmid:p3XFLAG-CMV-7-EBV gene ORFs (86 ORFs) Shair et al.36 N/A Plasmid:MSGV-LNGFR-P2ATCRα-F2A-TCRβ This paper N/A Plasmid:MSGV-CD8 Dr. David Baltimore from California Institute of Technology N/A Plasmid:pRD114 Addgene plasmid # 17576 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 43, 1–19.e1–e10, August 11, 2025 e2 ..

    Polymerase Chain Reaction:

    Article Title: Immunosequencing identifies signatures of T cell responses for early detection of nasopharyngeal carcinoma.
    Article Snippet: B3) BioLegend Cat#502512; RRID: AB_315236 Biological samples Serum samples from healthy individuals This paper N/A PBMC samples from NPC patients This paper N/A Tumor samples from NPC patients This paper N/A Chemicals, peptides, and recombinant proteins Human IL-2 Peprotech Cat#AF-200-02-500UG DMEM medium Gibco Cat#C11995500BT Penicillin-streptomycin Gibco Cat#15140-122 RPMI 1640 medium Hyclone Cat#SH30809.01 HEPES Gibco Cat#15630130 Sodium pyruvate Gibco Cat#11360070 Non-essential amino acids Gibco Cat#11140050 β-mercaptoethanol Sigma-Aldrich Cat#M6250 TransIT-293 Mirus Bio Cat#MIR2700 Polybrene Sigma-Aldrich Cat#TR-1003-G Liposome YEASEN Cat#40802ES03 Human serum Gemini Cat#100-512 PBS Gibco Cat#C20012500BT 7-AAD viability staining solution BioLegend Cat#420404 Permeabilization buffer Invitrogen Cat#00-8333-56 List of peptides GenScript Table S4 Critical commercial assays ELISA kit for EBV VCA-IgA Euroimmun Cat#EI 2791-9601 A DNeasy Blood Extraction kit Qiagen Cat#69506 AllPrep DNA/RNA Mini Kit Qiagen Cat#80204 QIAGEN Multiplex PCR Plus Kit QIAGEN Cat#206152 Phusion HotStart DNA polymerase kit Phusion Cat#4464269 Agencourt® Ampure® XP beads Beckman Coulter Cat#63881 Qubit dsDNA HS Assay Kit Invitrogen Cat#Q32854 NEBNext Ultra mRNA Library Prep Kit NEB Cat# E7530 Qubit dsDNA HS Assay Kit Invitrogen Cat#Q32851 KAPA Library Quant Kit universal qPCR Mix Illumina KK4824 NovaSeq S4 reagent Kit Illumina Cat#20028312 PrimeSTAR Takara Cat#R045B Nucleic acid extraction kit CWBIO Cat#CMY017S (Continued on next page) ll OPEN ACCESS Article e1 Cancer Cell 43, 1–19.e1–e10, August 11, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Protein purification kit NucleoSpin Cat#740609.250 Illumina Infinium Asian Screening Array-24 (v1.0) Illumina Cat#20016319 Deposited data Human tumor scRNA-seq data Bei et al.31 GSE162025 Human tumor scRNA-seq data Guan et al.37 GSE150825 Bulk RNA-seq data Zhang et al.38 GSE102349 Bulk TCR-seq data This paper OMIX database: PRJCA027151 VDJdb database (20191113) https://vdjdb.cdr3.net/ https://vdjdb.cdr3.net/ Experimental models: Cell lines Jurkat E6.1 ATCC CatTIB-152 HEK-293T ATCC Cat#CRL-3216 K562 ATCC Cat#CCL-243 HepG2 ATCC Cat#HB-8065 PBMCs for retroviral transduction Sailybio Cat#SLB-HP050B COS-7 Laboratory of Zeng YX. and Xu M. N/A HK1 Laboratory of Zeng YX. and Xu M. N/A C666 Laboratory of Zeng YX. and Xu M. N/A TCR-F5-Jurkat This paper N/A TCR-ID1-Jurkat This paper N/A SCT-K562 This paper N/A TCR-expressing primary T cells This paper N/A EBV ORF-transduced APCs This paper N/A Oligonucleotides Oligonucleotide pool encoding the EBV epitopes Twist Bioscience PCR primers for SCT cDNA library: 5′-GGACCCTCCGCATCC-3′and 5′-GGACCCTCCGCATCC-3′ This paper N/A PCR primer for SCT-Forward: 5′-AATGATACGGCGA CCACCGAGATCTACACTCTT TCCCTACACGACGCTCTTCC GATCTGGCCTGCTTTGTTTG CC-3′ This paper N/A PCR primer for SCT-Reverse, 5′GTGACTGGAGTTCAGACGT GTGCTCTTCCGATCTCCTCCA CCACCGCTACCTC-3′ This paper N/A Recombinant DNA Plasmid:pCCLc-peptide-β2M-HLA-eGFP This paper N/A Plasmid:pCCLc-β2M-HLA-eGFP Dr. David Baltimore from California Institute of Technology N/A Plasmid:pLV-luciferase-puromycin Addgene plasmid # 117734 Plasmid:p3XFLAG-CMV-7-EBV gene ORFs (86 ORFs) Shair et al.36 N/A Plasmid:MSGV-LNGFR-P2ATCRα-F2A-TCRβ This paper N/A Plasmid:MSGV-CD8 Dr. David Baltimore from California Institute of Technology N/A Plasmid:pRD114 Addgene plasmid # 17576 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 43, 1–19.e1–e10, August 11, 2025 e2 ..

    cDNA Library Assay:

    Article Title: Immunosequencing identifies signatures of T cell responses for early detection of nasopharyngeal carcinoma.
    Article Snippet: B3) BioLegend Cat#502512; RRID: AB_315236 Biological samples Serum samples from healthy individuals This paper N/A PBMC samples from NPC patients This paper N/A Tumor samples from NPC patients This paper N/A Chemicals, peptides, and recombinant proteins Human IL-2 Peprotech Cat#AF-200-02-500UG DMEM medium Gibco Cat#C11995500BT Penicillin-streptomycin Gibco Cat#15140-122 RPMI 1640 medium Hyclone Cat#SH30809.01 HEPES Gibco Cat#15630130 Sodium pyruvate Gibco Cat#11360070 Non-essential amino acids Gibco Cat#11140050 β-mercaptoethanol Sigma-Aldrich Cat#M6250 TransIT-293 Mirus Bio Cat#MIR2700 Polybrene Sigma-Aldrich Cat#TR-1003-G Liposome YEASEN Cat#40802ES03 Human serum Gemini Cat#100-512 PBS Gibco Cat#C20012500BT 7-AAD viability staining solution BioLegend Cat#420404 Permeabilization buffer Invitrogen Cat#00-8333-56 List of peptides GenScript Table S4 Critical commercial assays ELISA kit for EBV VCA-IgA Euroimmun Cat#EI 2791-9601 A DNeasy Blood Extraction kit Qiagen Cat#69506 AllPrep DNA/RNA Mini Kit Qiagen Cat#80204 QIAGEN Multiplex PCR Plus Kit QIAGEN Cat#206152 Phusion HotStart DNA polymerase kit Phusion Cat#4464269 Agencourt® Ampure® XP beads Beckman Coulter Cat#63881 Qubit dsDNA HS Assay Kit Invitrogen Cat#Q32854 NEBNext Ultra mRNA Library Prep Kit NEB Cat# E7530 Qubit dsDNA HS Assay Kit Invitrogen Cat#Q32851 KAPA Library Quant Kit universal qPCR Mix Illumina KK4824 NovaSeq S4 reagent Kit Illumina Cat#20028312 PrimeSTAR Takara Cat#R045B Nucleic acid extraction kit CWBIO Cat#CMY017S (Continued on next page) ll OPEN ACCESS Article e1 Cancer Cell 43, 1–19.e1–e10, August 11, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Protein purification kit NucleoSpin Cat#740609.250 Illumina Infinium Asian Screening Array-24 (v1.0) Illumina Cat#20016319 Deposited data Human tumor scRNA-seq data Bei et al.31 GSE162025 Human tumor scRNA-seq data Guan et al.37 GSE150825 Bulk RNA-seq data Zhang et al.38 GSE102349 Bulk TCR-seq data This paper OMIX database: PRJCA027151 VDJdb database (20191113) https://vdjdb.cdr3.net/ https://vdjdb.cdr3.net/ Experimental models: Cell lines Jurkat E6.1 ATCC CatTIB-152 HEK-293T ATCC Cat#CRL-3216 K562 ATCC Cat#CCL-243 HepG2 ATCC Cat#HB-8065 PBMCs for retroviral transduction Sailybio Cat#SLB-HP050B COS-7 Laboratory of Zeng YX. and Xu M. N/A HK1 Laboratory of Zeng YX. and Xu M. N/A C666 Laboratory of Zeng YX. and Xu M. N/A TCR-F5-Jurkat This paper N/A TCR-ID1-Jurkat This paper N/A SCT-K562 This paper N/A TCR-expressing primary T cells This paper N/A EBV ORF-transduced APCs This paper N/A Oligonucleotides Oligonucleotide pool encoding the EBV epitopes Twist Bioscience PCR primers for SCT cDNA library: 5′-GGACCCTCCGCATCC-3′and 5′-GGACCCTCCGCATCC-3′ This paper N/A PCR primer for SCT-Forward: 5′-AATGATACGGCGA CCACCGAGATCTACACTCTT TCCCTACACGACGCTCTTCC GATCTGGCCTGCTTTGTTTG CC-3′ This paper N/A PCR primer for SCT-Reverse, 5′GTGACTGGAGTTCAGACGT GTGCTCTTCCGATCTCCTCCA CCACCGCTACCTC-3′ This paper N/A Recombinant DNA Plasmid:pCCLc-peptide-β2M-HLA-eGFP This paper N/A Plasmid:pCCLc-β2M-HLA-eGFP Dr. David Baltimore from California Institute of Technology N/A Plasmid:pLV-luciferase-puromycin Addgene plasmid # 117734 Plasmid:p3XFLAG-CMV-7-EBV gene ORFs (86 ORFs) Shair et al.36 N/A Plasmid:MSGV-LNGFR-P2ATCRα-F2A-TCRβ This paper N/A Plasmid:MSGV-CD8 Dr. David Baltimore from California Institute of Technology N/A Plasmid:pRD114 Addgene plasmid # 17576 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 43, 1–19.e1–e10, August 11, 2025 e2 ..

    Recombinant:

    Article Title: Immunosequencing identifies signatures of T cell responses for early detection of nasopharyngeal carcinoma.
    Article Snippet: B3) BioLegend Cat#502512; RRID: AB_315236 Biological samples Serum samples from healthy individuals This paper N/A PBMC samples from NPC patients This paper N/A Tumor samples from NPC patients This paper N/A Chemicals, peptides, and recombinant proteins Human IL-2 Peprotech Cat#AF-200-02-500UG DMEM medium Gibco Cat#C11995500BT Penicillin-streptomycin Gibco Cat#15140-122 RPMI 1640 medium Hyclone Cat#SH30809.01 HEPES Gibco Cat#15630130 Sodium pyruvate Gibco Cat#11360070 Non-essential amino acids Gibco Cat#11140050 β-mercaptoethanol Sigma-Aldrich Cat#M6250 TransIT-293 Mirus Bio Cat#MIR2700 Polybrene Sigma-Aldrich Cat#TR-1003-G Liposome YEASEN Cat#40802ES03 Human serum Gemini Cat#100-512 PBS Gibco Cat#C20012500BT 7-AAD viability staining solution BioLegend Cat#420404 Permeabilization buffer Invitrogen Cat#00-8333-56 List of peptides GenScript Table S4 Critical commercial assays ELISA kit for EBV VCA-IgA Euroimmun Cat#EI 2791-9601 A DNeasy Blood Extraction kit Qiagen Cat#69506 AllPrep DNA/RNA Mini Kit Qiagen Cat#80204 QIAGEN Multiplex PCR Plus Kit QIAGEN Cat#206152 Phusion HotStart DNA polymerase kit Phusion Cat#4464269 Agencourt® Ampure® XP beads Beckman Coulter Cat#63881 Qubit dsDNA HS Assay Kit Invitrogen Cat#Q32854 NEBNext Ultra mRNA Library Prep Kit NEB Cat# E7530 Qubit dsDNA HS Assay Kit Invitrogen Cat#Q32851 KAPA Library Quant Kit universal qPCR Mix Illumina KK4824 NovaSeq S4 reagent Kit Illumina Cat#20028312 PrimeSTAR Takara Cat#R045B Nucleic acid extraction kit CWBIO Cat#CMY017S (Continued on next page) ll OPEN ACCESS Article e1 Cancer Cell 43, 1–19.e1–e10, August 11, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Protein purification kit NucleoSpin Cat#740609.250 Illumina Infinium Asian Screening Array-24 (v1.0) Illumina Cat#20016319 Deposited data Human tumor scRNA-seq data Bei et al.31 GSE162025 Human tumor scRNA-seq data Guan et al.37 GSE150825 Bulk RNA-seq data Zhang et al.38 GSE102349 Bulk TCR-seq data This paper OMIX database: PRJCA027151 VDJdb database (20191113) https://vdjdb.cdr3.net/ https://vdjdb.cdr3.net/ Experimental models: Cell lines Jurkat E6.1 ATCC CatTIB-152 HEK-293T ATCC Cat#CRL-3216 K562 ATCC Cat#CCL-243 HepG2 ATCC Cat#HB-8065 PBMCs for retroviral transduction Sailybio Cat#SLB-HP050B COS-7 Laboratory of Zeng YX. and Xu M. N/A HK1 Laboratory of Zeng YX. and Xu M. N/A C666 Laboratory of Zeng YX. and Xu M. N/A TCR-F5-Jurkat This paper N/A TCR-ID1-Jurkat This paper N/A SCT-K562 This paper N/A TCR-expressing primary T cells This paper N/A EBV ORF-transduced APCs This paper N/A Oligonucleotides Oligonucleotide pool encoding the EBV epitopes Twist Bioscience PCR primers for SCT cDNA library: 5′-GGACCCTCCGCATCC-3′and 5′-GGACCCTCCGCATCC-3′ This paper N/A PCR primer for SCT-Forward: 5′-AATGATACGGCGA CCACCGAGATCTACACTCTT TCCCTACACGACGCTCTTCC GATCTGGCCTGCTTTGTTTG CC-3′ This paper N/A PCR primer for SCT-Reverse, 5′GTGACTGGAGTTCAGACGT GTGCTCTTCCGATCTCCTCCA CCACCGCTACCTC-3′ This paper N/A Recombinant DNA Plasmid:pCCLc-peptide-β2M-HLA-eGFP This paper N/A Plasmid:pCCLc-β2M-HLA-eGFP Dr. David Baltimore from California Institute of Technology N/A Plasmid:pLV-luciferase-puromycin Addgene plasmid # 117734 Plasmid:p3XFLAG-CMV-7-EBV gene ORFs (86 ORFs) Shair et al.36 N/A Plasmid:MSGV-LNGFR-P2ATCRα-F2A-TCRβ This paper N/A Plasmid:MSGV-CD8 Dr. David Baltimore from California Institute of Technology N/A Plasmid:pRD114 Addgene plasmid # 17576 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 43, 1–19.e1–e10, August 11, 2025 e2 ..

    Plasmid Preparation:

    Article Title: Immunosequencing identifies signatures of T cell responses for early detection of nasopharyngeal carcinoma.
    Article Snippet: B3) BioLegend Cat#502512; RRID: AB_315236 Biological samples Serum samples from healthy individuals This paper N/A PBMC samples from NPC patients This paper N/A Tumor samples from NPC patients This paper N/A Chemicals, peptides, and recombinant proteins Human IL-2 Peprotech Cat#AF-200-02-500UG DMEM medium Gibco Cat#C11995500BT Penicillin-streptomycin Gibco Cat#15140-122 RPMI 1640 medium Hyclone Cat#SH30809.01 HEPES Gibco Cat#15630130 Sodium pyruvate Gibco Cat#11360070 Non-essential amino acids Gibco Cat#11140050 β-mercaptoethanol Sigma-Aldrich Cat#M6250 TransIT-293 Mirus Bio Cat#MIR2700 Polybrene Sigma-Aldrich Cat#TR-1003-G Liposome YEASEN Cat#40802ES03 Human serum Gemini Cat#100-512 PBS Gibco Cat#C20012500BT 7-AAD viability staining solution BioLegend Cat#420404 Permeabilization buffer Invitrogen Cat#00-8333-56 List of peptides GenScript Table S4 Critical commercial assays ELISA kit for EBV VCA-IgA Euroimmun Cat#EI 2791-9601 A DNeasy Blood Extraction kit Qiagen Cat#69506 AllPrep DNA/RNA Mini Kit Qiagen Cat#80204 QIAGEN Multiplex PCR Plus Kit QIAGEN Cat#206152 Phusion HotStart DNA polymerase kit Phusion Cat#4464269 Agencourt® Ampure® XP beads Beckman Coulter Cat#63881 Qubit dsDNA HS Assay Kit Invitrogen Cat#Q32854 NEBNext Ultra mRNA Library Prep Kit NEB Cat# E7530 Qubit dsDNA HS Assay Kit Invitrogen Cat#Q32851 KAPA Library Quant Kit universal qPCR Mix Illumina KK4824 NovaSeq S4 reagent Kit Illumina Cat#20028312 PrimeSTAR Takara Cat#R045B Nucleic acid extraction kit CWBIO Cat#CMY017S (Continued on next page) ll OPEN ACCESS Article e1 Cancer Cell 43, 1–19.e1–e10, August 11, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Protein purification kit NucleoSpin Cat#740609.250 Illumina Infinium Asian Screening Array-24 (v1.0) Illumina Cat#20016319 Deposited data Human tumor scRNA-seq data Bei et al.31 GSE162025 Human tumor scRNA-seq data Guan et al.37 GSE150825 Bulk RNA-seq data Zhang et al.38 GSE102349 Bulk TCR-seq data This paper OMIX database: PRJCA027151 VDJdb database (20191113) https://vdjdb.cdr3.net/ https://vdjdb.cdr3.net/ Experimental models: Cell lines Jurkat E6.1 ATCC CatTIB-152 HEK-293T ATCC Cat#CRL-3216 K562 ATCC Cat#CCL-243 HepG2 ATCC Cat#HB-8065 PBMCs for retroviral transduction Sailybio Cat#SLB-HP050B COS-7 Laboratory of Zeng YX. and Xu M. N/A HK1 Laboratory of Zeng YX. and Xu M. N/A C666 Laboratory of Zeng YX. and Xu M. N/A TCR-F5-Jurkat This paper N/A TCR-ID1-Jurkat This paper N/A SCT-K562 This paper N/A TCR-expressing primary T cells This paper N/A EBV ORF-transduced APCs This paper N/A Oligonucleotides Oligonucleotide pool encoding the EBV epitopes Twist Bioscience PCR primers for SCT cDNA library: 5′-GGACCCTCCGCATCC-3′and 5′-GGACCCTCCGCATCC-3′ This paper N/A PCR primer for SCT-Forward: 5′-AATGATACGGCGA CCACCGAGATCTACACTCTT TCCCTACACGACGCTCTTCC GATCTGGCCTGCTTTGTTTG CC-3′ This paper N/A PCR primer for SCT-Reverse, 5′GTGACTGGAGTTCAGACGT GTGCTCTTCCGATCTCCTCCA CCACCGCTACCTC-3′ This paper N/A Recombinant DNA Plasmid:pCCLc-peptide-β2M-HLA-eGFP This paper N/A Plasmid:pCCLc-β2M-HLA-eGFP Dr. David Baltimore from California Institute of Technology N/A Plasmid:pLV-luciferase-puromycin Addgene plasmid # 117734 Plasmid:p3XFLAG-CMV-7-EBV gene ORFs (86 ORFs) Shair et al.36 N/A Plasmid:MSGV-LNGFR-P2ATCRα-F2A-TCRβ This paper N/A Plasmid:MSGV-CD8 Dr. David Baltimore from California Institute of Technology N/A Plasmid:pRD114 Addgene plasmid # 17576 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 43, 1–19.e1–e10, August 11, 2025 e2 ..



    Similar Products

    99
    ATCC cell lines jurkat cells atcc cat
    Cell Lines Jurkat Cells Atcc Cat, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+jurkat+e6+1+atcc+cat/Jurkat%2C+Clone+E6-1/pm41265436-276-177-181
    Average 99 stars, based on 1 article reviews
    cell lines jurkat cells atcc cat - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    ATCC cell lines jurkat atcc cat
    Cell Lines Jurkat Atcc Cat, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+jurkat+e6+1+atcc+cat/Jurkat%2C+Clone+E6-1/pm40378042-526-217-220
    Average 99 stars, based on 1 article reviews
    cell lines jurkat atcc cat - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    ATCC cell lines jurkat e6 1 atcc cat
    Cell Lines Jurkat E6 1 Atcc Cat, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+jurkat+e6+1+atcc+cat/293T/pm40345188-287-58-62
    Average 99 stars, based on 1 article reviews
    cell lines jurkat e6 1 atcc cat - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    ATCC cell lines ccrf cem cells atcc cat
    Cell Lines Ccrf Cem Cells Atcc Cat, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+jurkat+e6+1+atcc+cat/Jurkat%2C+Clone+E6-1/pm35732190-200-203-207
    Average 99 stars, based on 1 article reviews
    cell lines ccrf cem cells atcc cat - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    ATCC cell lines 293t atcc cat
    Cell Lines 293t Atcc Cat, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+jurkat+e6+1+atcc+cat/Jurkat%2C+Clone+E6-1/pm35294870-242-147-150
    Average 99 stars, based on 1 article reviews
    cell lines 293t atcc cat - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results